FAQS & DISCUSSIONS

Discussion Group

Ayuda de traducción - Aide de traduction - Assistenza di traduzione - Übersetzungsunterstützung

Last modified: 4 December 2005

Please send any question you would like answered to the editor.
Or, if you know the answer to any of the questions please send that to the editor.
If you would like to participate in similar discussions, join CICLY
The following questions and discussions have been slightly edited and the original text can be found in the CICLY archives

Is there a protocol for developing polyclonal antisera for phytoplasma?

(Response from Dez Barbara)
Several procedures for producing polyclonal antisera to phytoplasmas derived from plants have been published, starting way back in 1983 with publications by the the groups of Chen (aster yellows if I remember correctly) and Clark (clover phyllody - work I was involved in and published as Clark M.F., Barbara, D.J. & Davies, D.L. (1983). Production and characteristics of antisera to Spiroplasma citri and clover phyllody associated antigens derived from plants. Annals of Applied Biology, 103, 251-259). Others that I can remember off the top of my head have been published to apple proliferation (groups of Seemuller and HRI), primula yellows (Clark again), flavescence doree (Boudon-Padieu I think). Similar approaches have been tried successfully against a number of other phytoplasmas both published and unpublished. These procedures are all based on purifying phytoplasma proteins (probably in association with membranes) from infected plants. They don't work with all phytoplasmas - HRI (the Institute where I work) has had trouble making good antisera to pear decline for example. In essence all treat the phytoplasma as if they were like viruses and generally require fairly good titres of the phytoplasma in the host. Generally they will probably not work that well with the sort of titres one is likely to get in heavily lignified perennial crops. All these procedures vary somewhat and really the best thing to do is (a) do a literature search a to find all the various procedures then compare them and try to understand the principles.(b) try one or more of these on the material. It is unlikely that any of the procedures will work directly on a new phytoplasma/host without some modification and will either need luck or modification. All the antisera raised this way that I have had experience of have some degree of anti-plant activity (not surprisingly) which even at low levels can affect their use. One alternative is to raise monoclonals but a completely different approach is to raise antisera to cloned/expressed immunodominant membrane protein - see below.

Is there a protocol for mapping of immunodomiant membrane protein genes?

(Response from Dez Barbara)

Phytoplasmas (in common with mycoplasmas, spiroplasmas, etc.) will have a reasonable number of membrane associated proteins - for phytoplasmas we don't know how many but it is reasonable to guess some dozens. I assume that whilst saying 'mapping' the request is for a protocol for the cloning and expression of the immunodominant membrane protein - I can't see the point of mapping the gene for a new phytoplasma as we know very little of the genome of most phytoplasmas. The problem with this enquiry is that at present for most phytoplasmas there are important factors we don't know. Published/in press/in preparation I know of immunodominant membrane proteins cloned from eight or so phytoplasmas - the problem is that whilst within a group, say apple proliferation and its relatives including the slightly distant sweet potato witches' broom, the same protein seems to be immunodominant; however, across the three groups (AP/SPWB, Western X, Aster yellows) three entirely separate and apparently unrelated (except in the broad sense of being membrane associated) proteins are immunodominant. One could take the protein which is immunodominant in one phytoplasma, say aster yellows, and try to clone the equivalent in Western X but we don't know (a) even if the equivalent protein exists and (b) if it does whether it would function as well as the 'natural' immunodominant protein from WX if you used it as an immunogen. This uncertainty is magnified for phytoplasmas where the 'natural' immunodominant protein is not known. Overall I'm trying to say that, whilst I think it would be scientifically extremely interesting and certainly worth investigating as a way of generating experimental/diagnostic tools, the of cloning membrane proteins from a phytoplasma such as LY not closely related to one for which it has already been done is not simply a matter of taking a protocol and 'Bob's your uncle' (as we English rather obscurely say for getting something done). We have thought long and hard about how it might be done for other phytoplamas but it certainly can't be reduced to simple protocol. Again I would recommend reading the literature first. Having said that, where relevant proteins have been cloned very good polyclonal antisera, free of anti-plant activity, and also monoclonals can be raised. Cloning these proteins also raises the possibilities of investigating the interaction between host and pathogen and psossibly developing novel resistances/control measures so I personally think it is a possibly very fruitful area worthy of more attention (and funding) than it gets.

Areca yellowing

The Areca palm that is common in Florida is Chrysalidocarpus lutescens (Dypsis lutescens). According to Bill Howard, nobody has ever seen LY in one of these palms. In the 1970s C. cabadae (D. cabadae) was found to be susceptible to LY. It was never widely planted in Florida, however, and so nobody has made any observations concerning susceptibility. Neodypsis decaryi (D. decaryi) was found to be susceptible to LY, probably in the late 1980s. It is more common and since there have not been many cases of LY reported in D. decaryi, we might regard it as 'slightly susceptible'.

Elsewhere the Areca palm, or Betel Palm, is Areca catechu and there is no information that this has been exposed to LY in the Caribbean-Latin American region or to similar phytoplasma diseases in east or west Africa. In the southern state of Kerala in India the yellowing of this palm has been attributed to a vector transmitted phytoplasma but the evidence but the validity of that claim has been questioned. The rest of this section deals with Areca catechu.

In Southern Peninsular India (Karnataka State), the areca palm is a cash crop. According to TJ Rajendra, the areca palms in the Western Ghat Mountain range of peninsular India (especially in and around Sringeri and adjoinging taluks) do suffer from a yellowing decline though the lethal phase starts only after five years of initial manifestation of symptoms, the palms survive for 10-15 years and a majority of diseased plants live at least for 30 to 40 years. As with cadang-cadang, circumstantial evidence points to mechanical transmission. The "diseased palms" show severe yellowing during during the rainly season and once summer sets they turn greenish. This could be explained with water logging, but the healthy plants do not show this seasonal yellowing. Further, it seems that only yellowing is seasonal, the health of the palms deteriorate unconditionally. May be that the infected palms are weak and succumb to water logging faster than the healthier ones and hence the manifest symptoms.

Controversial evidence for an insect vector was presented at the XXI International Entomological Congress in Iguassu, Brasil. "Biocontrol agents associated with Proutista moesta, a vector of phytoplasma diseases of palms, with particular reference to Halictophagus palmi". The authors were K. N. Ponnamma & B, Babjan of the National Research Centre for Oil Palm, Regional Station, Palode, Pacha 695582, Trivandrum District, Kerala, South India. The abstract stated "The planthopper Proutista moesta is a vector of root wilt disease of coconut palm, yellow leaf disease of areca nut, and a putative vector of spear rot disease of oil palm. The natural enemy complex - an endoparasitoid Halictophagus palmi (Strepsiptera), predators Maroissa flavus (Aracinidaea), Chelisoches moris (Dermaptera) and the fungal pathogen Aspergillus flavus play a vital role in the biological suppression of the vector. Bioecology, extent of parasitism potential of the strepsipteran parasite is presented".

Vectors of LYD in Ghana

In mid-November 1999, a question to CICLY-Onelist requested information on whether tests carried out with a Typhlocybinid leafhopper (Nzinga spp) which breeds only on coconut and oil palms in Ghana, indicated that it was a vector species of LYD in that country

The Typhlocybinid leafhopper (Nzinga palmivora) is predominant in the Western region of Ghana but transmission tests with this species were negative. In the Central Region of Ghana, there is another species of leafhopper, Myndus adiopodoomeensis (Cixiidae) which was also tested. On four trees, the appearance of what appeared to be initial disease symptoms, with shedding of nuts and yellowing of the lowest fronds, however, after 6 months, there was a remission of these symptoms. There was thus no positive response for Phytoplasmas following PCR analysis, and therefore, there is so far, no clear evidence that LYD in Ghana is transmitted by insects. This study has continued by application of PCR analysis to the detection of phytoplasmas in the the two species of insect tested, after a feeding period of 3 days on diseased trees but phytoplasmas were not detected but it was unsure what were the more-recent results using a new type of lyophilized restriction enzymes.

Was it likely that the M. adiopodoomeensis could have transmitted another pathogen such as a virus like Foliar Decay Virus, in view of the negative phytoplasma results?

It was not thought to be the case but needed to be re-checked on the PCR results using the new lyophilized restriction enzymes.

LYD disease can reappear in locations in Ghana that are apparently free of potential leafhopper vector species as is the case in the Upper Volta region, where the disease has been observed to re-appear 20-25 years after the disease first occurred. In view of this, and because LYD can spread slowly from a primary infection focus like an oil stain, might there also be a possibility that LYD in Ghana might be spread by a soil-inhabiting vector?

It has not yet observed whether there were insects on the root system or not but it would be interesting to check this possibility.

Do you know whether Offei and Dery, who reported feeding two leafhopper species for 3 days on diseased material, also tested these leafhoppers immediately after the 3-day acquisition period, or whether the leafhoppers were kept for two, three or more weeks before PCR testing? The incubation period of the LYD phytoplasma in Myndus crudus has not been established, as far as is known, and it might be a very long period. If it were 2-3 weeks, it is not very likely that PCR would detect the phytoplasmas after 3 days of acquisition feeding, but would so after a longer period.

It is not clear whether the leafhoppers were allowed to incubate the phytoplasma for 2-3 weeks or whether they were sacrificed for PCR analysis immediately after the 3-day acquisition feed.

If the test insects were fed on palm tissues relatively rich in phytoplasmas eg by caging them on necrotic spear leaf tissue, for 3 days, it might be possible that PCR, being a very sensitive technique, might amplify superficial phytoplasma-contamination of the mouthparts even without a lengthy incubation period, if the contaminating phytoplasma DNA remained structurally sound. Does that make sense or not?

It is theoretically possible.

There does not appear to be any information on the length of the incubation period of the Lethal Yellowing phytoplasma in Myndus crudus.

Handling M. crudus under experimental conditions is quite difficult as it is a very sensitive insect that that has a tendency to die in large numbers under experimental conditons. So there are some technical difficulties associated with measuring the incubation period of the Lethal Yellowing phytoplasma in M. crudus.

Breakthrough in Tolerant Coconut Variety in Ghana

A press release in the APCC Cocomunity Newsletter (Volume 29 No. 9 May 1999), under this title , stated that the coconut project of the Oil Research Institute of Ghana had achieved a breakthrough in its search for a tolerant variety of coconut germplasm. The release was excerpted from a paper entitled "Rehabilitation of the Coconut Industry in Ghana: Proposal for establishing coconut seed gardens and nurseries".

Apparently, screening trials set up some 16 years ago have shown that the only tolerant types are the Sri Lanka Green Dwarf (SGD), the Vanuatu Tall (VTT) and to a lesser extent the Malayan Yellow Dwarf x Vanuatu Tall (MYD x VTT). For economic reasons, the SGD and VTT are not suitable for release to farmers mainly because of the smallness of nuts, low copra and oil content, difficulty in extracting the copra from the shell and susceptibility to beetle attack. Under the project two hybrids; MYDxVTT and SGDxVTT are to be released to the farmers for growing.

This announcement generated the following comments:

• In the Annual report for 1993 of the STD III project on the Etiology and Control of Lethal Yellowing-type Diseases of Coconut Palm in Africa, Annex 1 - Table 7 shows that there were only 12 palms of the Vanua Tall variety to start with and that 3 of these went missing without any cause being given. A similar table, (updated to September 1995) appears on page 149 of the proceedings of the Iternational Workshop on Lethal Yellowing-like Diseases of Coconut which took place in Elmina, Ghana in November 1995. It shows that 1 of the surviving 9 Vanuatu Tall palms at one trial site was affected. It also shows that 11 Malayan Dwarf and 24 Sri Lanka Green Dwarf were exposed to disease at two sites. The MYDxVTT hybrid was represented by 5 palms at one site and the SGDxVTT was not present at either site. Unless there are other data that have not (yet) been made available [but see below] the small number of palms tested cannot be considered a good enough basis for claiming tolerance on which to base a rehabilitation or a replanting programme (and if neither the SGD or VTT are suitable for agronomic reasons then SGDxVTT is unlikely to be a winning combination either).

• Although, Panama Tall or PT hybrids were not included in the original screening trials started at that time, some PT and a few hybrids (although not thought to include material of recent Caribbean origin) have been introduced more recently. The older of these palms should by now be flowering (but not at an active disease site) and more recent introductions (at an active disease site) are still juvenile. The lack of PT, Maypan and other hybrids is now a well-recognised shortcoming of the original trials and steps have been taken to remedy this.

• A suggestion was made at the Elmina LY meeting that a survey should be made of the dwarf palms around farmers houses throughout the entire diseased area. These palms constitute an equally good (if not a better) test of resistance as there are hundreds of them, all in close proximity to local Ghana Tall (West African Tall) coconuts dying of disease. So far as is known, no-one took up the suggestion to monitor "backyard" plantings of MD in Ghana.

• These comments have been answered, as follows:

• Testing of coconut ecotypes for tolerance to the CSPWD started as far back as 1956 in the Volta Region of Ghana. According to Chona and Adansi (1970), a total of 68 MYD and 41 Malayan Green Dwarfs were planted at Cape St. Paul, Tegbi, Dzelukope and Ohawu. They all succumbed to the disease.

• The Crops Research Institute set up another trial at Cape Three Points in 1977 with MYD as one of the varieties under observation. Again all were wiped out by the disease.

• At Princess, the Crops Research Institute had established a research plot of 2 acres (120 palms) of MYD. This was not a screening trial, but when the disease got to Princess around 1976-1977 all of them were killed except one tree.

• In the on-going trials (started in 1982) emphasis was again put on the MYD which accounts for its presence on all 7 trials (always in relatively larger numbers compared to the others). The MYD's at the two sites, Dixcove and Cape Three Points have all been killed. At Agona Junction where the disease is now active (started in 1997), 9 out of the 24 MYD have been killed so far. None of the 8 VTT and the 16 SGD have been affected (Anon, 1998). The VTT and SGD again were not affected in Dixcove. At Cape Three Points, the SGD again was not affected although the VTT was not planted here.

• The MYD has consistently succumbed to the disease and with this in mind some believe there is a justification for shifting away from MYD.

• The observation that numerous MYD are found in homesteads in diseased areas is true to some extent. This is because CSPWD attacks the talls first. This led to an earlier erroneous conclusion that CSPWD does not attack young non-bearing palms. The truth is that the disease first attack the tall varieties and then the dwarfs. This has occurred over and over again. This has been observed in surveys and pictures have been taken of numerous MYD's in homesteads affected by the disease. It is normal to find the dwarfs apparently doing well in a disease focus but one has to wait till the disease has run its course before making conclusions.

• There are some MYD survivors as well as WAT survivors that need to be collected for inclusion in future trials.

• It is true that the numbers involved are quite small and this has been acknowledged over and over again. The disease has now affected the Agona Junction plot which has 8 VTT palms and they are doing well. The small numbers query is true for all the 38 ecotypes under test. The SGD has a 100% survival in Cape Three Points (18 palms), Dixcove (6 palms) and so far Agona Junction (?palms). The MYD has succumbed in all these places as well as other sites cited above. Can something be done with the SGD rather than the MYD ?

• The idea of planting large blocks for screening purposes would involve enormous cost. CSPWD spreads by jumps and you cannot predict where it will next appear. For such a method to be affordable you should be sure that your plantation will be affected soon. The plots at Agona Junction and Princess were disease free for 17 years before infection. Although we have the disease all around Axim and Dadwen the plots in these places, planted in 1982, have not been affected. If the planners of these trials had planted all their material in large blocks, who knows, 17 years on we may still have been waiting of the disease to infect the field. The block method will be very good when we are able to transmit the disease artificially. Otherwise the cost of establishment and maintenance is very high. Of course you could dispense with statistics (replication) but even then, large blocks of 38 ecotypes at 7 sites translates into a huge plantation. [Editor's Note: The concept of block exposure trials (Harries, 1998) has been misunderstood in the preceding paragraph. The size and number of blocks depends only on the funds available, the costs are those of normal agricultural work and presence or absence of the disease does not prevent the block from producing planting material for further tests].

• The variability of the VTT ex Cote d'Ivoire is real. It was not due to a mix-up. A cross check with the VTT plot in the Marc Delorme station in 1997 observed the same variability. In fact the variability is not between sites, as has been implied. At Dadwen and Princess the variability can be observed in adjacent palms.

References

Anon 1998-NARP Coconut Programme 1998 Annual Report Feb. 1999.

Chona B.L. and Adansi M.A. (1970) Coconut in Ghana. Crops Research Institute Bulletin No. 3 Council for Scientific and Industrial Research (CSIR) Kwadaso, Kumasi-Ghana.

Harries, H.C. (1998) Breeding phytoplasma disease resistant coconut: alternative field exposure trial strategies. Proc. Int. Cashew & Coconut Conference, Dar es Salaam, Tanzania, February 1997.

Teracycline

I would be interested to get members' responses and their attitudes to the use of teracycline antibiotics as a treatment against lethal yellowing disease in the field. I realise that this has been used extensively in Florida against the disease and I believe, it is also currently in use in Belize.This is in spite of the fact that tetracycline is not curative of the disease and therefore requires re-treatment of palms 3-4 times per year.

Also, what are your views on tetracycline-treatment of palms being potentially instrumental in the evolution of new strains of the lethal yellowing phytoplasma which could bypass any resistance which may be incorporated into economically desirable coconut hybrids in the future?

Does tetracycline-treatment have any place in integrated control of lethal yellowing?

As you know, in Florida the oxytetracycline injections were never recommended as the sole method of controlling LY. The doctrine was that injection programmes were not useful unless combined with replanting with resistant varieties of coconut palm (or perhaps resistant species of palms, if the palms are grown as ornamental plants). Since injections would have to be continued indefinitely to keep the palm healthy, the strategy was to keep the old stand of palms alive until a new planting was well established.

In Florida, LY programmes were organized by particular communities. Some were effective, some were not. The programme of the Town of Palm Beach is often mentioned as one of the more effective programmes. That community kept up a wellinjection programme for many years, and thus conserved much of their old stand of 'Jamaica Tall' coconut -supervised palms along the streets and in parks and on beaches. Early in this programme, they interplanted with 'Malayan dwarf' and 'palms. These LY-resistant palms are now mature, and Palm Beach looks a lot like it did during the 1960's, Maypan' coconut that isimpressive 'forest' of coconut palms. Most of the palms are 'Maypans' and 'Malayan dwarf' coconut palms. , it has an Some of the Tall" palms remain, but the stand has been thinned out due to various causes - I don't think anybody has 'Jamaica kept an accurate count of how many of the injected 'Jamaica Tall' palms have been lost, or the causal factor in each case. Lightning has eliminated some of them, I've seen fungal conks on some of them, and LY may have even got to some of them.

Antibiotic treatments have not been widely used on palms in Florida for many years. It is not a good long-term solution and was never conceived as such. Resistant palms remain the most important component in any LY management programme.

A quick calculation shows that the level obtainable by the usual injection could no possibly achieve Minimum Inhibitory Concentration, let alone sustain it long enough to inhibit ribosomal RNA replication of the phytoplasma organism

In that the organism lacks a characteristic cell wall and, thereby fails to elicits a significant antibody response there is no opportunity to develop a vaccine in the usual sense (not unlike HIV vaccine problems).

I would sure like to see some scientific controlled studies as well as demonstration of the organism in the living tree.A quick calculation shows that the level obtainable by the usual injection could no possibly achieve MIC, let alone sustain it long enough to inhibit ribosomal RNA replication of the phytoplasma organism.

Treatment of LY infected palms by oxytetracycline(OT) is based on work done over 20 years ago that demonstrated that the antibiotic has a half-life of 2 weeks in the coconut palm and showed that in palms pressure injected with 6g of OT, 20ug of OT /g fresh weight leaf tissue was detectable 2 days post injection. Look in Phytopathology 66, 1038. Bioassays have shown these levels to be inhibitory to culturable mycoplasmas.


In that the organism lacks a characteristic cell wall and, thereby fails to elicits a significant antibody response there is no opportunity to develop a vaccine in the usual sense (not unlike HIV vaccine problems).

I would sure like to see some scientific controlled studies as well as demonstration of the organism in the living tree.

It is wrong to assume that because phytoplasmas don't have a cell wall no significant immune response can be elicited. Polyclonal antisera and monoclonal antibodies have been raised to a large number of phytoplasmas (but not as far as is known any from coconut) in several labs. Where available, these antibodies can allow rapid, effective detection using simple serological techniques like ELISA. As with most other organisms (particularly viruses) it has proved possible to develop antibodies which have broad specificity and others which are "species" specific. Almost certainly all phytoplasmas are capable of being used as immunogens if one one can get round the problems of some being more difficult to extract and purify than others. Whilst it is true that antisera to bacteria are often (but not always) directed at cell-wall bound antigens this is probably largely because (a) that is the bit on the outside and therefore usefully placed for serological purposes such as host defence or serological detection and (b) knowing 'a' people often specifically prepare cell wall fractions for use as antigens. An immunological reaction requires only that a suitable immunogen is presented to the animal in the right way.

Generally speaking proteins make the best antigens and biological membranes are not bland lipid layers but are usually packed with various proteins. In phytoplasmas there is most often a single (but sometimes two) immunodominant antigenic protein in cell membrane preparations. These proteins are largely located on the outside of the cell but anchored to it by a transmembrane region and have a short a C-terminal segment within the phytoplasma's cytoplasm. The function of these membrane porteins is as yet unknown but we are now working to understand them through molecular cloning and study of the protein expressed in more amenable organisms like E. coli. This should also allow us to prepare antisera to other difficult-to-purify phytoplasmas. Clearly "vaccines" in the human/animal sense of injecting a material to invoke an immune response in the organism to be protected is not possible in plants as they do not have the direct equivalent of an antibody producing system. However, now that antibodies are available, people are attempting to protect plants by expressing animal antibodies in transgenic plants to induce resistance (see poster G24 by Le Gall and others at the Sydney IOM conference last year for example). This hasn't yet met with stunning success but is a potentially interesting approach. Similar approaches are being attempted by expressing phytoplasma membrane proteins in plants in the expectation that they may interfere with specific host-pathogen interactions, thereby "immunising" the plant or stopping transmission.

The problem in Oaxaca

We all know the classical symptoms of coconut lethal yellowing, could you please describe the problem in Oaxaca, I am very curious to understand why the controversy?

During 1996 a survey was made in the Oaxaca region, specifically to check for coconut palms showing lethal yellowing symptoms. This was a precautionary measure because phytopathologists in Oaxaca, as in Brazil or many other places, know that it is necessary to take precautions against an outbreak of LY.

As you, and all other palm pathologists will know, if you look for a yellow palms you will be sure to find some. Identifying the cause of the yellowing is not always so easy.

Prior to the development of PCR techniques, the preliminary identification of LY depended on sending someone who was familiar with the full LY syndrome to go and look at the sick palms. Even then, there were reports of LY which never became epidemic and which were, presumably, misidentifications.

Visualation by electronmicroscopy was not particularly helpful because good samples could usually only be found in palms at just the right stage of disease development. By the time positive "MLO" is "seen" the outbreak is usually widespread and obvious even to the "untrained" eye.

The hope, therefore, in 1996 was that any yellow palms could be sampled and quickly tested by PCR for the presence of phytoplasma and sequenced for the particular LY phytoplasma (specialists please correct me if my terminology is inadequate).

So the samples taken from yellow coconut palms in Oaxaca were sent to laboratories (more than one laboratory) where these PCR tests could be made.

I am not at liberty to say what those laboratories reported. As far as I know the results have yet to be reported in a scientific publication.

For the moment, it is enough to say that the field symptoms do not match those of lethal yellowing.

Laboratory tests are on-going, and I hope that a report will be made at the up-coming coconut biotechnology meeting <http://www.mpiz-koeln.mpg.de/~rohde/workshop99.html> in November-December, if not before.

One of the reasons that a complete set of symptoms cannot be reported is because the yellowing palms were cut down before they died "naturally". Hence, it is not yet known if it is a "lethal" or a "decline" yellowing.

That may appear to be "playing with words" and "splitting hairs" but it makes a big difference to the farmer concerned, who can continue getting some crop for some from a decline disease where he will lose his entire crop very quickly from a lethal disease.

But the message I really want to get across is that the any farmer (even those in Brazil and not just those in Oaxaca) should immediately begin replanting with varieties and hybrids that are expected to show some resistance to LY. It is no use waiting for confirmation that it is LY and then bewailing the fact that no variety or hybrid is 100% resistant. Planting resistant hybrids is a positive step because, unless the farmer is very unlucky, he will get some crop from well-cared-for, precocious hybrids even if many of them do eventually succumb to disease.

Has anyone yet been able to locate phytoplasma profiles in Myndus crudus tissues by electron microsocopy of thin sections?

In the conference book "Lethal Yellowing: Research and Practical aspects" edited by C.Oropeza, F.W.Howard and G.R.Ashburner (pages 88-89) it is stated that pathogen-specific PCR readily detected the Lethal Yellowing agent in 36 of 94 Myndus crudus planthoppers collected solely from the foliage of a non-bearing Atlantic Tall coconut palm, with mid-stage foliar yellowing symptoms.

What is "fatal yellowing" of oil palm in Brazil?

• It was previously called "Guia podre" or spear rot. It was also called Bud rot. It is known in Colombia, in Ecuador in Peru under the name of "pudricion de cogollo". Symptoms are really very different from LY. The disease starts with a chlorosis of the spear leaf, leaves 1 and 2 then a bud rot. Etiological research was conducted in the eighties by different teams in Canada, Germany and France. Only a few things were published because nothing was found. Research for a vector in Ecuador and in Brazil failed too. Recently a Brazilian paper reported it is not a" biotic disease"

At a symposium in India some 18 months ago (1997) JC Zadoks gave a paper on Epidemic Spread, one of the examples he quoted was a study he had been involved with on Fatal Yellowing. His conclusion from the study of its epidemiology was that it was caused by an infectious agent with an airborne vector. I don't think this work has been reported elsewhere or if it has been continued.

• JC Zadoks, worked at the review of the "Perenial Crops Department of CIRAD" (including ex IRHO) at the beginning of the 90s. Then he had the opportunity to visit one oil palm plantation in Brazil where we were working at this time (Claude Louise, entomologist). We provided him all the informations we had about the propagation of the disease including the studies made by our statistician colleagues from CIRAD who studied the phytosanitary data (new cases occuring evry month). From all these studies in this oil palm plantation in Para State made with our Brazilian colleagues, as well for Ecuadorian plantations it seemed that an aerial propagation could envisaged. Nevertheless, everybody knows that this kind of study is very subjective as far we have no information at all about the etiology. And, all the entomologists who worked on the research of an aerial insect vector failed . . . ( B. Perthuis spent 10 years in Ecuador trying to find this possible vector !). The other problem, again, concerned the symptomatology. Nobody can say today , the disease in Brazil is the same as the disease in Ecuador or in Colombia. As a matter of fact, the speed and the way of the propagation of the wilt in Brazil and Surinam, is very different from the one in Ecuador. In conclusion I would like to say, all doors are open for any hypothesis relative to this or these wilts of Oil Palm in South America. But one thing is sure: it is a spear rot, with a following bud rot, (it is not a yellowing starting on the lower leaves) and the trials of transmission with the cixiid found in Para State were negative.

Considering some of the discussions that have taken place recently on oil palm diseases, the reference below is likely be of interest to some colleagues. Certainly gives food for thought on the possible causes of spear rot.

van der Lande, H.L. and Zadoks, J.C. 1999. Spatial patterns of spear rot in oil palm plantations in Surinam. Plant Pathology 48: 189 - 201.

What is Dry Bud Rot?

• There are several disorders called DBR in the world . . . as usual. The first and well described was in Cote d'Ivoire. It is a nursery disease and it is transmitted by the planthopper Sogatella kolophon and S cubana. It seems that this disease is not a phytoplasma disease: no MLO in EM, and tetracycline treatments are negative (on the contrary, in the same conditions, Blast is sensitive). It could be a virus disease as the vector of DBR tranmit a virus-probably a reovirus on Digitaria. This is the result of the CIRAD research in Cote d'Ivoire published in Oleagineux and it is a part of my thesis (M.Dollet). I know that different kind of" DBR" have been found in other places : Africa,Pacific, South America, but most of them are not nursery diseases. I think there are several different disorders under this name. It was said that DBR in the fields in Africa could be also the same disease as the Ringspot disease of Oil Palm occuring in South America. But in this case the main symptom is a ringspot and it is not lethal . . . Then the main thing I could recommand again and again is to try to really describe the symtoms one can observe and not to try to give an already given name of any disease already known. I know it is not so easy to decribe a coconut or an Oil Palm disorder.

  Another DBR was found in Indonesia. The Rothamsted team -at the beginning of the eighties?- found a MLO in EM. ( I was not convinced by the pictures, but it is published).

Is it possible to extract DNA from EM blocks for PCR studies?

• Back in the late 70s Phil Jones looked at a coconut disease in North Sumatra and Malaysia that Peter Turner and Ray Kenten had called Coconut Stem Necrosis. After a lot of EM studies for viruses and phytoplasmas he found bodies that looked like phytoplasmas. The work was published in the Perak Planters Journal. No antibiotic studies were done and molecular methods were not available. If he was doing the work today he would want molecular and/or antibiotic studies to confirm aetiology.

  Phil still has the EM blocks and is wondering if it might be possible to extract DNA from these for PCR studies. This sort of study would open up a whole vault of speciments from other suspected phytoplasma diseases that could be tested.

  If anyone is willing to fund a project contact Phil or CICLY.

The Bands and Profiles debate (August 1999)

Is any one backing-up, on a regular basis the presence of gel bands with phytoplasma profiles identified in thin sections in atleast a representative number of check tissues? Or, is it all PCR now?

What worries me these days is, what appears to me to be an almost blind reliance on the presence of what are seen to be phytoplasma amplification bands on agarose gels after PCR treatment of suspected phytoplasma-containing extracts with supposed phytoplasma-specific primers.

• One certainly gets that impression but I believe there is the strong possibility with such a sensitive technique as PCR for contamination etc to occur. I fully concur that one major problem is that the basics of identified organism=causal disease has been lost by many diagnostic practitioners. (Commonly referred to by the muddy boots brigade of diagnosticians as the 'gene jockeys' or 'test tube twiddlers'.) In particular for phytosanitary regulatory action we need to be convinced that these relationships, no matter how refined the science, do in fact exist. We have experience of small RNA fractions in coconuts stopping exchange of germplasm when no consitent relationship to a disease has been demonstated (Ikin 1997.IPGRI/ACIAR Workshop in Malaysia). When trade depends on science we have to be very careful that the case for control has been demonstrated.

If I may be so bold to speak on behalf of some of the gene jockeys and test tube twiddlers! As far as PCR is concerned: Yes there is always the remote chance that a contaminant might cause mis-identification in PCR. To guard against this it is standard practice to use numerous checks and balances in the PCR technique. The mere presence of a band on a gel, especially when using the conserved 16S gene does not signify anything more than "amplify-able 16S"- As standard practice, most of us "gene jockeys" use some form of confirmation of identity, such as restriction enzyme profiles, or sequences from the intergenic spacers.

On the EM side- when is an "artifact" a phytoplasma- and how can you be sure that with the extremely small sample that you use in thin sectioning, that you are not missing an unevenly distributed pathogen? How can you be sure that what you see in thin sections might not be a different form of a phytoplasma, or phytoplasma in unusual orientation? As far as I know nobody has yet shown collusively that all phyto's look the same, and what they look like during all stages of a full life-cycle.

To my mind, diagnostics should rest as joint responsibility between the gene jockeys and muddy boots brigade! The ultimate answer would rest in what was suggested recently- trying to amplify PCR product from samples prepared for EM- this would tie up the two pieces of evidence until such time that a different method of identifying these beast are found.

I agree that we should not shout "wolf" every time when something is amplified in PCR, but to follow findings up with more evidence, and ultimately with as much "classic" evidence as possible.- Roll on the time when we would be able to do full Koch's postulates on these organisms!

• My point exactly. Diagnosis of phytoplasma diseases in the current state of scientific capability needs to be a shared responsibility between the DNA technologists and electron microscopists ie to show an association between the presence of bands on gels after use of phytoplasma-specifc primers and the presence of recognizable phloem-restricted phytoplasma profiles from the same tissue samples. As you say there is always going to be a problem with locating phytoplasmas in tissue when they are in low concentration (as well as with phytoplasma-like artifact profiles) even though bands may be readily isolated on gels. In this case however, I suppose, you will never be sure that the remote chance of contamination has not occurred.

Moreover, this goes for phytoplasma diseases as well. Nobody seems to bother in test Koch's postulates. Yes, I know... phytoplasmas can not be cultured in vitro... but hey there are clever ways to get around it. PCR is the golden test now (if done properly). The problem with amplifying Phytoplasma DNA is that most of the "universal" primers are indeed fairly universal. Before trying any PCR assay with reported primers, try running their sequences against the GenBank database . . . a real surprise will be waiting . . . A PCR band is just that . . . a band. You will have to sequence it, in order to really know you are amplifying Phytoplasma DNA. I am very skeptical even with the PCR-RFLP (now called ARDRA= Amplified ribosomal DNA restriction analysis) that have been proposed by Lee and others. Nobody seems to bother in sequencing at least a few of them, to really know if they are dealing with our "bugs" (Phytoplasmas).

Just as an example (you could try any of the Universal ones) . . . let's see one of the most used Universal primers <R16F2=acgactgctgctaagactgg> against the GenBank:

Please note that I am only pointing out GenBank sequences that perfectly align to the 3' end of the primer..

Some details ommitted

. . . so, you better do not sneeze close to your tubes B-)

• I can understand misgivings about results from PCRs, but I think there is overwhelming evidence to demonstrate that the technique is as reliable as the TEM but more sensitive, quicker and more cost-effective. Its no use doing PCRs without proper controls and when used for diagnostic tests we try and do additional tests such as restriction enzyme digestions and sequencing. If we're dealing with a newly identified phytoplasma disease then we'd try to get as much information as possible including TEM, antibiotic therapy and vector information. Sometimes its just not possible.

  Provided your sampling is done so as to avoid contamination then the likelihood of false positives arising as very small. After all A. palmae which you may expect to be a frequent contaminant of some coconut sampling is easily distinguished from members of the phytoplasmas. Thats not to say there isn't a place for electron microscopy but they have never been cheap to use and will never be as widely available as serological or molecular diagnostics have become. Its certainly a luxury to have project or core funding that gives you lots of TEM time these days.

  I don't think that today's diagnosticians have lost sight of the pathogen as causal organism. I think that there are so many external forces at play in germplasm exchange that one would have to err on the side of caution. It will be interesting to see just what are the outcomes of the viroid sequences in healthy coconuts and the incorporation of plant virus genomes into healthy hosts such as banana.

This page is under continuous review. If you have an idea or an opinion to improve the contents of the page or the site, tell the editor. If you disagree with anything, say so. If you don't see or get a satisfactory response in a reasonable time contact other participants. At all time keep in contact with other individuals; this site is not a substitute for person to person contact.

Return to Home Page

Return to Top